Python Playground

i have a dataset (for compbio people out there, it's a FASTA) that is littered with newlines, t… Read more Pandas Read Csv Ignore Newline

I want to install the Biopython module. So I used the command sudo apt-get install python-biopython… Read more Why Installing Package And Module Not Same In Python?

from Bio import SeqIO from Bio import SeqRecord from Bio import SeqFeature for rec in SeqIO.parse(&… Read more Storing The Output To A Fasta File

I have encountered an error which I am not able to resolve. I am trying to perform the easiest set … Read more Biopython Error - The System Cannot Find The File Specified

I am using python to create a program that converts a set of DNA sequences into amino acid (protein… Read more How To Convert A Set Of Dna Sequences Into Protein Sequences Using Python Programming?

# File Name RandonProteinSequences.py # standard library import os import random # biopython from … Read more Importerror: No Module Named Writers.seqrecord.fasta

I have a problem with printing my output from muscle aligning in python. My code is: from Bio.Align… Read more Muscle Alignment In Python

I have a DNA sequence and would like to get reverse complement of it using Python. It is in one of … Read more Reverse Complement Of Dna Strand Using Python

I am trying to use Biopython (Entrez) with search terms that will return the accession number (and … Read more Using Search Terms With Biopython To Return Accession Numbers

Using a typical pdb file, I am able to calculate the distance between two atoms in a structure usin… Read more Biopython PDB: Calculate Distance Between An Atom And A Point

I have this error appearing in my Django app on my production server : [Errno 13] Permission denie… Read more Errno 13 Permission Denied With Django On A Directory I Don't Want To Use

from a string say dna = 'ATAGGGATAGGGAGAGAGCGATCGAGCTAG' i got substring say dna.format = &… Read more How To Select Only Certain Substrings